traits tutorial
for v0.3.0
Installation
Install and load traits into the R session. Stable version from CRAN
install.packages("traits")
Or development version from Github:
if (!require("devtools")) install.packages("devtools")
devtools::install_github("ropensci/traits")
library("traits")
Usage
BetyDB
Get trait data for Willow (Salix spp.)
(salix <- betydb_search("Salix Vcmax"))
#> # A tibble: 14 x 36
#> access_level author checked citation_id citation_year city
#> * <int> <chr> <int> <int> <int> <chr>
#> 1 4 Wullschleger 1 51 1993 <NA>
#> 2 4 Wang 1 381 2010 <NA>
#> 3 4 Merilo 1 430 2005 Saare
#> 4 4 Merilo 1 430 2005 Saare
#> 5 4 Merilo 1 430 2005 Saare
#> 6 4 Merilo 1 430 2005 Saare
#> 7 4 Merilo 1 430 2005 Saare
#> 8 4 Merilo 1 430 2005 Saare
#> 9 4 Merilo 1 430 2005 Saare
#> 10 4 Merilo 1 430 2005 Saare
#> 11 4 Merilo 1 430 2005 Saare
#> 12 4 Merilo 1 430 2005 Saare
#> 13 4 Merilo 1 430 2005 Saare
#> 14 4 Merilo 1 430 2005 Saare
#> # ... with 30 more variables: commonname <chr>, cultivar <chr>,
#> # cultivar_id <int>, date <chr>, dateloc <chr>, entity <lgl>,
#> # genus <chr>, id <int>, lat <dbl>, lon <dbl>, mean <dbl>,
#> # method_name <lgl>, month <int>, n <int>, notes <chr>, raw_date <chr>,
#> # result_type <chr>, scientificname <chr>, site_id <int>,
#> # sitename <chr>, species_id <int>, stat <dbl>, statname <chr>,
#> # time <chr>, trait <chr>, trait_description <chr>, treatment <chr>,
#> # treatment_id <int>, units <chr>, year <int>
# equivalent:
# (out <- betydb_search("willow"))
Summarise data from the output data.frame
library("dplyr")
salix %>%
group_by(scientificname, trait) %>%
mutate(.mean = as.numeric(mean)) %>%
summarise(mean = round(mean(.mean, na.rm = TRUE), 2),
min = round(min(.mean, na.rm = TRUE), 2),
max = round(max(.mean, na.rm = TRUE), 2),
n = length(n))
#> mean min max n
#> 1 48.06 19.99 79.28 14
NCBI sequence data
Get sequences by id
ncbi_byid(ids = "360040093")
#> taxon
#> 1 Eristalis transversa
#> gene_desc
#> 1 Eristalis transversa voucher CNC:Diptera:102013 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
#> gi_no acc_no length
#> 1 360040093 JN991986.1 658
#> sequence
#> 1 tactttatattttgtatttggaacatgagcgggtatagtaggaacttcattaagaattttaattcgagctgaattaggtcatccaggtgcattaattggtgatgatcaaatttataatgttattgtaacagctcatgcttttgttataattttttttatagtaatacctattataattggaggatttggaaattgattagtaccacttatattaggagctccagatatagcattccctcgaataaataatataagtttctgattattacctccttctttaactctattattagtaagaagtatagtagaaaatggggctggaacaggatgaacagtttatcctccattatcaagtaatattgcacatggaggagcctcagttgatttagcaattttttcacttcacttatcaggaatatcatctattttaggtgcagtaaattttattacaacagttattaatatacgatcaacaggaattacttatgatcgtatacctttatttgtttgatctgttgctattacagctttattattattattatcattaccagtactagcaggagctattacaatattattaactgatcgaaatttaaatacatcattctttgatccagcaggaggaggagaccctatcctgtaccaacacttattc
Get sequences searching by taxonomic name
out <- ncbi_searcher(taxa = "Umbra limi", seqrange = "1:2000")
head(out)
#> taxon length
#> 1 Umbra limi 761
#> 2 Umbra limi 765
#> 3 Umbra limi 764
#> 4 Umbra limi 743
#> 5 Umbra limi 758
#> gene_desc
#> 1 Umbra limi voucher NXG2012264 rhodopsin (Rho) gene, partial cds
#> 2 Umbra limi voucher NXG201250 rhodopsin (Rho) gene, partial cds
#> 3 Umbra limi voucher NXG2012183 rhodopsin (Rho) gene, partial cds
#> 4 Umbra limi voucher NXG201252 rhodopsin (Rho) gene, partial cds
#> 5 Umbra limi voucher NXG2012231 rhodopsin (Rho) gene, partial cds
#> acc_no gi_no
#> 1 KX146134 1049488959
#> 2 KX146015 1049488721
#> 3 KX145969 1049488629
#> 4 KX145777 1049488245
#> 5 KX145759 1049488209
#> [ reached getOption("max.print") -- omitted 1 row ]
EOL’s Traitbank data
Note that EOL’s Traitbank does not allow us to search by trait. The only interface we have is to search by taxon page ID.
Searching for Potus flavus, page id 328574
res <- traitbank(pageid = 328574)
res$graph %>%
select(dwc.measurementtype,
dwc.measurementvalue) %>%
filter(!is.na(dwc.measurementvalue))
Coral
Get the species list and their ids
coral_species()
#> # A tibble: 1,548 x 2
#> name id
#> <chr> <chr>
#> 1 Acanthastrea brevis 3
#> 2 Acanthastrea echinata 4
#> 3 Acanthastrea hemprichi 6
#> 4 Acanthastrea ishigakiensis 8
#> 5 Acanthastrea regularis 12
#> 6 Acanthastrea rotundoflora 13
#> 7 Acanthastrea subechinata 14
#> 8 Acropora abrolhosensis 16
#> 9 Acropora abrotanoides 17
#> 10 Acropora aculeus 18
#> # ... with 1,538 more rows
Get data by taxon
coral_taxa(80)
#> # A tibble: 3,540 x 25
#> observation_id access user_id specie_id specie_name location_id
#> <int> <int> <int> <int> <chr> <int>
#> 1 157133 1 10 80 Acropora hyacinthus 1
#> 2 156961 1 14 80 Acropora hyacinthus 409
#> 3 5781 1 1 80 Acropora hyacinthus 1
#> 4 156610 1 2 80 Acropora hyacinthus 500
#> 5 158118 1 10 80 Acropora hyacinthus 409
#> 6 119211 1 49 80 Acropora hyacinthus 1
#> 7 158211 1 10 80 Acropora hyacinthus 413
#> 8 90294 1 15 80 Acropora hyacinthus 341
#> 9 90294 1 15 80 Acropora hyacinthus 341
#> 10 90294 1 15 80 Acropora hyacinthus 341
#> # ... with 3,530 more rows, and 19 more variables: location_name <chr>,
#> # latitude <dbl>, longitude <dbl>, resource_id <int>,
#> # resource_secondary_id <int>, measurement_id <int>, trait_id <int>,
#> # trait_name <chr>, standard_id <int>, standard_unit <chr>,
#> # methodology_id <int>, methodology_name <chr>, value <chr>,
#> # value_type <chr>, precision <dbl>, precision_type <chr>,
#> # precision_upper <dbl>, replicates <int>, notes <chr>
Get data by trait
coral_traits(105)
#> # A tibble: 0 x 25
#> # ... with 25 variables: observation_id <lgl>, access <lgl>,
#> # user_id <lgl>, specie_id <lgl>, specie_name <lgl>, location_id <lgl>,
#> # location_name <lgl>, latitude <lgl>, longitude <lgl>,
#> # resource_id <lgl>, resource_secondary_id <lgl>, measurement_id <lgl>,
#> # trait_id <lgl>, trait_name <lgl>, standard_id <lgl>,
#> # standard_unit <lgl>, methodology_id <lgl>, methodology_name <lgl>,
#> # value <lgl>, value_type <lgl>, precision <lgl>, precision_type <lgl>,
#> # precision_upper <lgl>, replicates <lgl>, notes <lgl>
Birdlife International
Habitat data
birdlife_habitat(22721692)
#> id Habitat (level 1) Habitat (level 2) Importance
#> 1 22721692 Forest Subtropical/Tropical Dry suitable
#> 2 22721692 Forest Subtropical/Tropical Moist Montane major
#> 3 22721692 Forest Temperate suitable
#> 4 22721692 Shrubland Subtropical/Tropical High Altitude suitable
#> Occurrence
#> 1 breeding
#> 2 non-breeding
#> 3 breeding
#> 4 breeding
Threats data
birdlife_threats(22721692)
#> id threat1
#> 1 22721692 Agriculture & aquaculture
#> 2 22721692 Agriculture & aquaculture
#> 3 22721692 Biological resource use
#> threat2
#> 1 Annual & perennial non-timber crops
#> 2 Annual & perennial non-timber crops
#> 3 Logging & wood harvesting
#> stresses
#> 1 Ecosystem degradation, Ecosystem conversion
#> 2 Ecosystem degradation, Ecosystem conversion
#> 3 Ecosystem degradation
#> timing
#> 1 Agriculture & aquaculture
#> 2 Agriculture & aquaculture
#> 3 Biological resource use
#> scope severity impact
#> 1 Annual & perennial non-timber crops Ongoing Ongoing
#> 2 Annual & perennial non-timber crops Ongoing Ongoing
#> 3 Logging & wood harvesting Ongoing Ongoing
#> [ reached getOption("max.print") -- omitted 3 rows ]
Citing
To cite traits in publications use:
Scott Chamberlain, Zachary Foster, Ignasi Bartomeus, David LeBauer and David Harris (2017). traits: Species Trait Data from Around the Web. R package version 0.3.0. https://CRAN.R-project.org/package=traits
License and bugs
- License: MIT
- Report bugs at our Github repo for traits
